Alignment result for job RA995778337

Name of Chain_1: RA995778337A.pdb (to be superimposed onto Chain_2)
Name of Chain_2: RA995778337B.pdb
Length of Chain_1: 180 residues
Length of Chain_2: 292 residues

Aligned length= 179, RMSD=   2.08, Seq_ID=n_identical/n_aligned= 0.190
TM-score= 0.87980 (if normalized by length of Chain_1, i.e., LN=180, d0=5.54)
TM-score= 0.57339 (if normalized by length of Chain_2, i.e., LN=292, d0=7.74)
(You should use TM-score normalized by length of the reference structure)

(":" denotes residue pairs of d <  5.0 Angstrom, "." denotes other aligned residues)
---------tatgaaccgtactgtcgtctgcggcctttgattatcaattaaag-cgttctacggcgtttttgatcgctcaactgtgcgagctagatc-tca-----------------------------------------------------------------------------------------tatgagatcta-gctcgcacagttgagcgatcaaaaacgccgtagaacgct-ttaattgataatcaaaggccgcagacgacagtacggttca-----------
         :::::::::::::::::::::::::::::::::::::::::::: ::::::::::::::::::::::::::::::::::::::::::: :::                                                                                         ::: ::::::: ::::::::::::::::::::::::::::::::::::::: ::::::::::::::::::::::::::::::::::::::::           
atccaaatggattcgaatggaatcattgaatggaaatgaatggaatcattggttggactcaaatggaattttcgaacaggctcaaatggaatcttcgaatggattcgaatgtaatcattttcgaatggattcgaatggaatctgatatcagattccattcgaatccattcgaaaatgattacattcgaatcca-ttcgaagattccatttgagcctgttcgaaaattccatttgagtccaaccaatgattccattcatttccattcaatgattccattcgaatccatttggat

Total CPU time is  0.21 seconds 

Superposition (Chain_1 in blue and Chain_2 in red)

(water of Chain_1 and Chain_2 in blue and red, respectively; non-water ligand of Chain_1 and Chain_2 in cyan and pink, respectively).

Result download

• Chain_1 (before superposition): RA995778337A.pdb.
• Chain_2 (before superposition): RA995778337B.pdb.
• Chain_1 superposed to Chain_2 (with Chain_2): RA995778337.pdb.
• Chain_1 superposed to Chain_2 (without Chain_2): RA995778337super.pdb.
All the above files will be removed from the server after 2 days.

Reference:

• Sha Gong, Chengxin Zhang, Yang Zhang (2019) RNA-align: quick and accurate alignment of RNA 3D structures based on size-independent TM-score_RNA. DOI: 10.1093/bioinformatics/btz282