7fhi	A	20	NA		URS00023119FD_10090	34791286					10090	ggaugcuuacucagccaucc	<<<<<<<.....>>>.>>>>	(((((((.....))).))))	Interaction between a fluoroquinolone derivative and RNAs with a single bulge; RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*CP*AP*UP*CP*C)-3')
7fj0	A	20	NA		URS0002311993_10090	34791286					10090	ggaugcuuacucagcgaucc	<<<<<<<.....>>>.>>>>	(((((((.....))).))))	Interaction between a fluoroquinolone derivative and RNAs with a single bulge; RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*GP*AP*UP*CP*C)-3')
8i43	A	19	NA		URS00026813C1_10090	36999159					10090	ggacgcuuucgagccgucc	<<<<<<<....>>>.>>>>	(((((((....))).))))	Interaction between a fluoroquinolone derivative KG022 and RNAs: effect of base pairs 3' adjacent to the bulge out residues; RNA-C-3GC-uucg
8i44	A	19	NA		URS00026813D1_10090	36999159					10090	ggaugcuuucgagccaucc	<<<<<<<....>>>.>>>>	(((((((....))).))))	Interaction between a fluoroquinolone derivative KG022 and RNAs: effect of base pairs 3' adjacent to the bulge out residues; RNA-C-3AU-uucg
8i45	A	19	NA		URS00026813CE_10090	36999159					10090	ggacgcuuucgagcggucc	<<<<<<<....>>>.>>>>	(((((((....))).))))	Interaction between a fluoroquinolone derivative KG022 and RNAs: effect of base pairs 3' adjacent to the bulge out residues; RNA-G-3GC-uucg
8i46	A	19	NA		URS00026813C5_10090	36999159					10090	ggaugcuuucgagcgaucc	<<<<<<<....>>>.>>>>	(((((((....))).))))	Interaction between a fluoroquinolone derivative KG022 and RNAs: effect of base pairs 3' adjacent to the bulge out residues; RNA-G-3AU-uucg