6tf1	A	52	2.4	RF03013	URS00021ED92A_204669	32295864					204669	ggcuucaacaaccccguagguugggccgaaaggcagcgaaucuacuggagcc	<<<<<<.........<<<<<<<..<<<....>>>....>>>>>>>.>>>>>>	(((((((.....[[.((((((((.(((....))).])]))))))))))))))	Crystal structure of the ADP-binding domain of the NAD+ riboswitch with Adenosine diphosphate (ADP); Chains: A
7d7x	A	51	2.631	RF03013	URS00021ED902_32630	33170270					32630	gcuucaacaaccccguagguggggacgaaagucagcgcaccuacuggagcc	<<<<<.........<<<<<<<..<<<....>>>....>>>>>>>.>>>>>.	((((((.....[[.((((((((.(((....))).])]))))))))))))).	Crystal Structure of the Domain1 of NAD+ Riboswitch with adenosine diphosphate (ADP); 18GAAA(52-MER)
9tl1	R	25	1.704								11520	guaguaacaagagucugcuucugcu	<<<<.<<<.<<<.>>>>.>>>>>>.	((((.(((.(((.)))).)))))).	Structure of duck RIG-I (delta CARDs) bound to 31-mer RNA mismatched hairpin with 5'ppA-U blunt end mimicking the influenza B virus vRNA promoter (panhandle) and to ADP.; 31-mer RNA hairpin with 5'ppA-U blunt end mimicking the influenza B virus vRNA promoter (panhandle).