1am0	A	16	NA		URS000080E211_32630	8700212					32630	gggaagaaacuguagc	................	(...........().)	AMP RNA APTAMER COMPLEX, NMR, 8 STRUCTURES; RNA APTAMER
1raw	A	36	NA		URS000080E162_32630	8756406					32630	gggaagggaagaaacugcggcuucggccggcuuccc	<<<<<<...........<<<<....>>>>.>>>>>>	((((((...........((((....)))).))))))	ATP BINDING RNA APTAMER IN COMPLEX WITH AMP, NMR, 10 STRUCTURES; RNA APTAMER
6tb7	A	52	2.53	RF03013	URS00021ED92A_204669	32295864					204669	ggcuucaacaaccccguagguugggccgaaaggcagcgaaucuacuggagcc	<<<<<<.........<<<<<<<..<<<....>>>....>>>>>>>.>>>>>>	(((((((.....[[.((((((((.(((....))).])]))))))))))))))	Crystal structure of the ADP-binding domain of the NAD+ riboswitch with Adenosine monophosphate (AMP); RNA
6ymi	A	25	2.5		URS0001A24B50_1907202	32520325					1907202	gguacaacggcuuccuggcgugacc	<<<<<..............>>.>>>	(((((..(........)..)).)))	Crystal structure of the SAM-SAH riboswitch with AMP.; Chains: A,C,F,I,M,O
6ymi	C	25	2.5		URS0001A24B50_1907202	32520325					1907202	gguacaacggcuuccuggcgugacc	<<<<<..............>>.>>>	(((((..(........)..)).)))	Crystal structure of the SAM-SAH riboswitch with AMP.; Chains: A,C,F,I,M,O
6ymi	F	25	2.5		URS0001A24B50_1907202	32520325					1907202	gguacaacggcuuccuggcgugacc	<<<<<..............>>.>>>	(((((..(........)..)).)))	Crystal structure of the SAM-SAH riboswitch with AMP.; Chains: A,C,F,I,M,O
6ymi	I	25	2.5		URS0001A24B50_1907202	32520325					1907202	gguacaacggcuuccuggcgugacc	<<<<<..............>>.>>>	(((((..(........)..)).)))	Crystal structure of the SAM-SAH riboswitch with AMP.; Chains: A,C,F,I,M,O
6ymi	M	25	2.5		URS0001A24B50_1907202	32520325					1907202	gguacaacggcuuccuggcgugacc	<<<<<..............>>.>>>	(((((..(........)..)).)))	Crystal structure of the SAM-SAH riboswitch with AMP.; Chains: A,C,F,I,M,O
6ymi	O	26	2.5		URS0001A24B50_1907202	32520325					1907202	ggunacaacggcuuccuggcgugacc	<<<<<<..............>>>>>>	((((((..(........)..))))))	Crystal structure of the SAM-SAH riboswitch with AMP.; Chains: A,C,F,I,M,O
6yml	A	26	2.17		URS0001A24B50_1907202	32520325					1907202	ggunacaacggcuuccuggcgugacc	<<<<<<..............>>>>>>	((((((..(........)..))))))	Crystal structure of the SAM-SAH riboswitch with decarboxylated SAH; Chains: A,C
8sx6	B	14	1.45			37920395					32630	nnnnacuuaagucg	..............	..............	RNA duplex bound with GMP and AMP monomers; RNA (5'-R(*(TLN)P*(LCC)P*(LCC)P*(LCG)P*AP*CP*UP*UP*AP*AP*GP*UP*CP*GP*G)-3')
8sxl	A	14	1.9		URS0002681414_32630	37920395					32630	nnnnacuuaagucu	..............	..............	RNA UU template binding to AMP monomer; RNA (5'-R(*(TLN)P*(TLN)P*(LCA)P*(LCG)P*AP*CP*UP*UP*AP*AP*GP*UP*CP*U)-3')
8sxl	B	14	1.9		URS0002681414_32630	37920395					32630	nnnnacuuaagucu	..............	..............	RNA UU template binding to AMP monomer; RNA (5'-R(*(TLN)P*(TLN)P*(LCA)P*(LCG)P*AP*CP*UP*UP*AP*AP*GP*UP*CP*U)-3')