1ykv	A	11	3.3		URS000080DF4A_32630	15723077					32630	ggagcucgccc	...........	...........	Crystal structure of the Diels-Alder ribozyme complexed with the product of the reaction between N-pentylmaleimide and covalently attached 9-hydroxymethylanthracene; Diels-Alder ribozyme
1ykv	B	38	3.3		URS000080DEAC_32630	15723077					32630	gggcgaggccgugccagcucuucggagcaauacucggc	.......<<<<.....<<<<<..>>>>>......>>>>	.......((((.....((((....))))......))))	Crystal structure of the Diels-Alder ribozyme complexed with the product of the reaction between N-pentylmaleimide and covalently attached 9-hydroxymethylanthracene; Diels-Alder ribozyme
1ykv	C	11	3.3		URS000080DF4A_32630	15723077					32630	ggagcucgccc	...........	...........	Crystal structure of the Diels-Alder ribozyme complexed with the product of the reaction between N-pentylmaleimide and covalently attached 9-hydroxymethylanthracene; Diels-Alder ribozyme
1ykv	D	38	3.3		URS000080DEAC_32630	15723077					32630	gggcgaggccgugccagcucuucggagcaauacucggc	.......<<<<.....<<<<<..>>>>>......>>>>	.......((((.....((((....))))......))))	Crystal structure of the Diels-Alder ribozyme complexed with the product of the reaction between N-pentylmaleimide and covalently attached 9-hydroxymethylanthracene; Diels-Alder ribozyme
1yls	A	11	3.0		URS000080DF4A_32630	15723077					32630	ggagcncgcnc	...........	..........	Crystal structure of selenium-modified Diels-Alder ribozyme complexed with the product of the reaction between N-pentylmaleimide and covalently attached 9-hydroxymethylanthracene; RNA Diels-Alder ribozyme
1yls	B	38	3.0		URS000080E1B2_32630	15723077					32630	gggngaggncgugccggcncuncggagcaauacucggc	.......<<<<.....<<<<....>>>>......>>>>	.......((((.....(((...).))......))))	Crystal structure of selenium-modified Diels-Alder ribozyme complexed with the product of the reaction between N-pentylmaleimide and covalently attached 9-hydroxymethylanthracene; RNA Diels-Alder ribozyme
1yls	C	11	3.0		URS000080DF4A_32630	15723077					32630	ggagcncgcnc	...........	..........	Crystal structure of selenium-modified Diels-Alder ribozyme complexed with the product of the reaction between N-pentylmaleimide and covalently attached 9-hydroxymethylanthracene; RNA Diels-Alder ribozyme
1yls	D	38	3.0		URS000080E1B2_32630	15723077					32630	gggngaggncgugccggcncuncggagcaauacucggc	.......<<<<.....<<<<....>>>>......>>>>	.......((((.....(((...).))......))))	Crystal structure of selenium-modified Diels-Alder ribozyme complexed with the product of the reaction between N-pentylmaleimide and covalently attached 9-hydroxymethylanthracene; RNA Diels-Alder ribozyme