4pqu	T	21	2.508		URS000080E09D_32630	24880687,22266819,19812032,20852643,18230722,11250910					32630	ggucggcgcccgaacagggac	.....................	.....................	Crystal structure of HIV-1 Reverse Transcriptase in complex with RNA/DNA and dATP; 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*CP*CP*GP*AP*AP*CP*AP*GP*GP*GP*AP*CP*UP*GP*UP*G)-3'
4pqu	E	21	2.508		URS000080E09D_32630	24880687,22266819,19812032,20852643,18230722,11250910					32630	ggucggcgcccgaacagggac	.....................	.....................	Crystal structure of HIV-1 Reverse Transcriptase in complex with RNA/DNA and dATP; 5'-R(*AP*UP*GP*GP*UP*CP*GP*GP*CP*GP*CP*CP*CP*GP*AP*AP*CP*AP*GP*GP*GP*AP*CP*UP*GP*UP*G)-3'
6ar1	C	14	3.01		URS0000CBFF22_32630	29153391					32630	uuuguugccuggag	..............	..............	Structure of a Thermostable Group II Intron Reverse Transcriptase with Template-Primer and Its Functional and Evolutionary Implications (RT/Duplex (Nat)); RNA
6ar1	F	14	3.01		URS0000CBFF22_32630	29153391					32630	uuuguugccuggag	..............	..............	Structure of a Thermostable Group II Intron Reverse Transcriptase with Template-Primer and Its Functional and Evolutionary Implications (RT/Duplex (Nat)); RNA
6ar3	C	14	3.41		URS0000CBFF22_32630	29153391					32630	uuuguugccuggag	..............	..............	Structure of a Thermostable Group II Intron Reverse Transcriptase with Template-Primer and Its Functional and Evolutionary Implications (RT/Duplex (Se-Met)); RNA