2et5	A	21	2.2		URS000080E2C5_32630	16214802					32630	gcgucacaccggugaagucgc	.....................	.....................	Complex Between Ribostamycin and the 16S-RRNA A-Site; 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'
2et5	B	21	2.2		URS000080E2C5_32630	16214802					32630	gcgucacaccggugaagucgc	.....................	.....................	Complex Between Ribostamycin and the 16S-RRNA A-Site; 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3'
2fcz	A	23	2.01		URS000080E167_32630	16679451					32630	cungcugaagugcacacagcaag	<<<<<<<.........>>>>>>>	(((((((.........)))))))	HIV-1 DIS kissing-loop in complex with ribostamycin; HIV-1 DIS RNA
2fcz	B	23	2.01		URS000080E167_32630	16679451					32630	cungcugaagugcacacagcaag	<<<<<<<.........>>>>>>>	(((((((.........)))))))	HIV-1 DIS kissing-loop in complex with ribostamycin; HIV-1 DIS RNA
2fcz	C	23	2.01		URS000080E167_32630	16679451					32630	cungcugaagugcacacagcaag	<<<<<<<.........>>>>>>>	(((((((.........)))))))	HIV-1 DIS kissing-loop in complex with ribostamycin; HIV-1 DIS RNA
2fcz	D	23	2.01		URS000080E167_32630	16679451					32630	cungcugaagugcacacagcaag	<<<<<<<.........>>>>>>>	(((((((.........)))))))	HIV-1 DIS kissing-loop in complex with ribostamycin; HIV-1 DIS RNA
2kxm	A	27	NA		URS000080DFEC_32630	20632338,20306311					32630	ggcugcuuguccuuuaaugguccaguc	<<<<<...<.<<......>>.>>>>>>	(((((...(.((......)).))))))	Solution NMR Structure of the 27 nucleotide engineered neomycin sensing riboswitch RNA-ribostmycin complex; RNA (27-MER)
2n0j	A	27	NA		URS000080DFEC_32630	26661511,20306311					32630	ggcugcuuguccuuuaaugguccaguc	<<<<<...<.<<......>>.>>>>>>	(((((...(.((......)).))))))	Solution NMR Structure of the 27 nucleotide engineered neomycin sensing riboswitch RNA-ribostamycin complex; RNA_(27-MER)
3c3z	A	23	1.5		URS000080E167_32630	18435520					32630	cungcugaagugcacacagcaag	.......................	......................	Crystal structure of HIV-1 subtype F DIS extended duplex RNA bound to ribostamycin; HIV-1 subtype F genomic RNA
3c3z	B	23	1.5		URS000080E167_32630	18435520					32630	cungcugaagugcacacagcaag	.......................	......................	Crystal structure of HIV-1 subtype F DIS extended duplex RNA bound to ribostamycin; HIV-1 subtype F genomic RNA
3dvv	A	23	2.0		URS000080E167_32630						32630	cungcugaagugcacacagcaag	.......................	.......................	Crystal structure of HIV-1 subtype F DIS extended duplex RNA bound to ribostamycin (U267OMe); HIV-1 genomic RNA
3dvv	B	23	2.0		URS000080E167_32630						32630	cungcugaagugcacacagcaag	.......................	.......................	Crystal structure of HIV-1 subtype F DIS extended duplex RNA bound to ribostamycin (U267OMe); HIV-1 genomic RNA